Molecular Identification of Domestic and Wild Boars Using Cytochrome-b Specific Primers for Halal Authentication

The subject of adulterating wild boar and pig meat products with other animal meat is delicate, particularly in the Muslim nation of Indonesia. In recent years, there has been a lot of concern over halal meat products that contain wild boar and pig meat due to Economically Motivated Adulteration (EMA). However, there are limited studies of PCR-DNA-based to discriminate between domestic pigs and wild boars. This study aims to design species-specific primers to identify wild boar in the cytochrome-B gen region. DNA from seven animals (wild boar, pig, cow, sheep, goat, chicken, and fish) was extracted. Both conventional and real-time PCR were used for qualitative and quantitative identification. The cytochrome-B gene of wild boar and pig was sequenced, and this region was then used to design primers using PrimeQuest. Designed primers were characterized by four criteria: specificity, sensitivity, limit detection, and repetition tests. The set of primers designed for amplification consisted of Cyt-B Forward171 5'CGAGACGTAAATTACGGATGAC'3 and Reverse-488 5'GGTAATGATGAAGGGCAGGATG'3. The results of this study showed the primer amplificated wild boar DNA, specifically with an annealing temperature of 53°C, performed in a 25 cycle RT-PCR system. Good recommendations were shown by the sensitivity test (R2 = 0.9817, slope =-3,4742, y-intercept = 30,625; and efficiency = 94). In conclusion, the adulteration of wild boar meat in food products can be detected using a specially designed primer. The proposed primer can be used to identify wild boars in products sold on the commercial market, according to the results of qualitative and quantitative tests. © 2025 Rifqi, Edi Suryanto, Ari Surya Sukarno, Rusman, Nanung Agus Fitriyanto, Abdul Rohman and Yuny Erwanto.