Dharmayanthi, Anik Budhi and Pratama, Rahadian and Sánchez, Karmele Llano and Nurillah, Andini and Fadiah, Fina and Komara, null and Nugraha, R. Taufiq Purna and Saputra, Sugiyono and Nurkanto, Arif and Fahroni, Agus and Irwanto, Agus and Syafruddin, Din and Adnan, Iskandar Alisyahbana and Saragih, Jessica R. and Coutrier, Farah Novita and Setiadi, Wuryantari and Lobo, Neil F. (2025) Correction: The mitochondrial genome sequence of the Bornean orang-utan (Pongo pygmaeus) malaria parasite, Plasmodium pitheci (Malaria Journal, (2025), 24, 1, (321), 10.1186/s12936-025-05487-3). Malaria Journal, 24 (1): 368. ISSN 14752875
Correction The mitochondrial genome.pdf - Published Version
Restricted to Registered users only
Available under License Creative Commons Attribution Non-commercial No Derivatives.
Download (765kB) | Request a copy
Abstract
Following publication of the original article 1, in Methods section, the first sentence in Stage 2 has been corrected. From: The fragmented P. pitheci mt genome was used to design species-specific primers using Primer3 ver 2.3.7 in Geneious Prime (www.geneious.com). Primer Plasmonew_F: 5ʹ CATGCTCAGCCGCCAAAAAT 3ʹ and Plasmo-new_R: 5ʹ ACGGTCTGTATTGTTCTGCTCA 3ʹ were applied on all 23 DNA samples mixed with LongAmp® Taq 2X Master Mix (NEB) to amplify the ~ 5.8 kb genome (Fig. 2). To: Primers previously used by Pacheco et al. 6 were applied on all 23 DNA samples mixed with LongAmp® Taq 2X Master Mix (NEB) to amplify the ~ 5.8 kb genome (Fig. 2). The original article 1 has been updated. © The Author(s) 2025.
| Item Type: | Article |
|---|---|
| Additional Information: | Cited by: 0; All Open Access; Gold Open Access; Green Open Access |
| Uncontrolled Keywords: | erratum |
| Subjects: | R Medicine > RB Biomedical Sciences |
| Divisions: | Faculty of Medicine, Public Health and Nursing > Biomedical Sciences |
| Depositing User: | Ani PURWANDARI |
| Date Deposited: | 09 Apr 2026 07:49 |
| Last Modified: | 09 Apr 2026 07:49 |
| URI: | https://ir.lib.ugm.ac.id/id/eprint/26273 |
