Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride

This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 'GCTTGTCCGACCATCTTGCA 3' and ABC2 R 5 'AGGTCCACTCCCATGCTACA 3' that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was
exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation.
The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei
gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed.