The employment of real-time polymerase chain reaction coupled with species-specific primer for analysis of wild boar meat for halal authentication

Wild boar meat (WBM) is considered one of the non-halal meats which are typically used as meat adulterant. WBM is non-halal meat which can be found in meatballs and sausages products, therefore, the detection of WBM is very essential for halal authentication analysis. The objective of this study was to use real-time polymerase chain reaction combined with species-specific primers. Primers were in silico designed and the selected primers were checked for their specificity in several DNAs extracted from corresponding raw meats. The specificity of real-time PCR using primers targeting ND5, Forward: TCGCCTCACTCACATTAACC and Reverse: GGGACTAGGCTGAGAGTGAA was tested against DNA templates extracted from different meat species. The annealing temperature (Ta) was also optimized to get Ta with optimum amplification. Some characteristic performances which were related to quantitative analysis using real-time PCR were also determined including detection limit, efficiency value and repeatability. The results showed that the primer used could amplify DNAs extracted from WBM and pork. The capability of primers to only amplify WBM and pork is significant because both types of meat are non-halal. Furthermore, real-time PCR using ND5 primer is capable of amplifying DNAs as low as 5 ng. Real-time PCR using species-specific primer provides reliable results for the authentication of halal meats and can be used as routine monitoring in halal authentication analysis. © 2023 The Authors. Published by Rynnye Lyan Resources.